Y-DNA haplogroups are useful to determine whether two apparently unrelated individuals sharing the same surname do indeed descend from a common ancestor in a not too distant past (3 to 20 generations). All G-M377 men tested so far also have a rare null value for the DYS425 marker, (a missing "T" allele of the DYS371 palindromic STR), the result of a RecLOH event, a finding not yet seen among most other G haplotypes. For this are several indications. Y chromosome genetic variation in the Italian peninsula is clinal and supports an admixture model for the Mesolithic-Neolithic encounter. In north-eastern Croatia, in the town of Osijek, G was found in 14% of the males. Haplogroup G2a1 (also known as G-FGC753 and previously as G-L293) and its subclades represent the majority of haplogroup G samples in some parts of the Caucasus Mountains area. Kayser M, Caglia A, Corach D et al. Haplogroup G is a branch on the maternal tree of human kind. Concerning the presence of hg G in the Caucasus, one of its distinguishing features is lower haplogroup diversity in numerous populations (Supplementary Table S1) compared with Anatolia and Armenia, implying that hg G is intrusive in the Caucasus rather than autochthonous. Genome Res 2008; 18: 830838. Should any man with the P15 mutation test negative (ancestral) for any of these or vice versa, that finding would be the basis of a new G2a category. Haplogroup G1 is a primary subclade of haplogroup G . Origin and Migrations of Haplogroup G-M201 The first man to carry haplogroup G-M201 likely lived in southwestern Asia or the Caucasus between 46,000 and 54,000 years ago. Amongst the Madjars, G1 was found at a rate of 87%. The International Society of Genetic Genealogy (ISOGG) maintains the most up-to-date consensus version of haplogroup categories. The G2 clade consists of one widespread but relatively infrequent collection of P287*, M377, M286 and M287 chromosomes versus a more abundant assemblage consisting of G2a-related P15*, P16 and M485-related lineages. Origin, Diffusion, and Differentiation of Y-Chromosome Haplogroups E Eur J Hum Genet 2003; 11: 535542. Haplogroup G represents one of the first peoples in Europe. Google Scholar. The M201 SNP mutation that characterizes haplogroup G was identified at Stanford University and was first reported in 2001. Here we present the haplogroup frequency distribution and STR variation of 16 informative G sub-clades by evaluating 1472 haplogroup G chromosomes belonging to 98 populations ranging from Europe to Pakistan. Rosser ZH, Zerjal T, Hurles ME et al. It encompasses a small group of Hispanic men who also so far all have the odd value of 13,21 at the YCA marker. Pericic M, Lauc LB, Klaric IM, Janicijevic B, Rudan P : Review of croatian genetic heritage as revealed by mitochondrial DNA and Y chromosomal lineages. Y-chromosomal diversity in Lebanon is structured by recent historical events. There were only a few G categories until 2008 when major revisions to categories were made. Haplogroup F is the parent of haplogroups from G to R; however excluding these common haplogroups, the minor clades F*, F1, and F2, seem to appear in the Indian continent [68]. The highest reported concentration of G1 and its subclades in a single country is in Iran, with next most frequent concentrations in neighboring countries to the west. The general frequency pattern of hg G overall (Figure 2a) shows that the spread of hg G extends over an area from southern Europe to the Near/Middle East and the Caucasus, but then decreases rapidly toward southern and Central Asia. The frequency pattern and the microsatellite network of E-M2(xM191) indicate a West African origin followed by expansion, a result that is in agreement with the findings of Cruciani et al. The SNP L497 encompasses these men, but most G-L497 men belong to its subclade G-Z725, also known as G-DYS388=13. In the Near/Middle East, the highest P303 frequency is detected among Palestinians (17.8%), whereas in Europe the frequency does not exceed 6%. Using Y-STR data, the Td expansion time for all combined P15-affiliated chromosomes was estimated to be 150822217 years ago. See more. The genome-wide structure of the Jewish people. Ann Hum Genet 2005; 69: 443454. The formula for the coalescence calculations is as follows: Age=25/1000 ASD0/0.00069. 8 Oldest Haplogroups and the Regions they Originated From Haplogroup G men who belong to this group, but are negative for all G2a subclades, are uncommon in Europe but may represent a sizeable group in so far poorly tested areas east of Turkey. [10], A skeleton found at the Neolithic cemetery known as Derenburg Meerenstieg II, in Saxony-Anhalt Germany, apparently belonged to G2a3 (G-S126) or a subclade. Digora, North Ossetia has the highest known concentration of G in a single city, as 74% of the tested men were G.[14] Haplogroup G is found as far east as northern China in small percentages where G can reach more substantial percentages in minority groups such as the Uyghurs. (Behar et al., 2012b) Origin Most researchers consider the birthplace of G to have been born in East Asia. Haplogroup - an overview | ScienceDirect Topics First, the G2a1-P16 lineage is effectively Caucasus specific and accounts for about one-third of the Caucasian male gene pool (Figure 2f). OS thanks the Italian Ministry of the University: Progetti Ricerca Interesse Nazionale 2009 and FIRB-Futuro in Ricerca 2008 and Fondazione Alma Mater Ticinensins. In the Tirol (Tyrol) of western Austria, the percentage of G-M201 can reach 40% or more; perhaps the most famous example is the ancient remains of the so-called "Iceman", tzi. PubMedGoogle Scholar. Armenian DNA Project - News | FamilyTreeDNA SR thanks the Estonian Science Foundation for grant 7445 and M Metspalu for grant 8973. Beginning in 2008, additional G SNPs were identified at Family Tree DNA (L designations) and Ethnoancestry (S designations). Mitochondrial DNA and Y Chromosome Variation Provides Evidence for a Recent Common Ancestry between Native Americans and Indigenous Altaians. Excavating Y-chromosome haplotype strata in Anatolia. Spatial frequency maps for sub-clades (panels bf) were obtained by applying the frequencies from Supplementary Table S1 using the Surfer software (version 8, Golden Software, Inc.), following the kriging algorithm with option to use bodies of water as breaklines. Distribution. [25], In the Middle East, haplogroup G accounts for about 3% of the population in almost all areas. [15] Among the samples in the YHRD database from the southern Caucasus countries, 29% of the samples from Abazinia, 31% from Georgia, 2% from Azerbaijan and 18% from Armenia appear to be G samples. Paleolithic Y-haplogroup heritage predominates in a Cretan highland plateau. (2000) suggested 17,000 years ago. This is achieved by comparing the haplotypes through the STR markers. Proc Natl Acad Sci USA 2011; 108: 97889791. The members of G-PF3359 are probably smaller in number than men included in G-P303, but only a small amount of testing has occurred for the relevant mutations. The Sea Peoples, from cuneiform tablets to carbon dating. The most commonly occurring subclades are G1* (M285) and many subclades of G2 (G-P287), especially: G2a (P15), G2a1 (G-FGC7535, formerly G-L293), G2a2b2a (G-P303) formerly G2a3b1); G2a2b1 (G-M406) formerly G2a3a; G2a2b2a1 (G-L140) formerly G2a3b1a; G2a2b2a1a1b (G-L497) formerly G2a3b1a2; G2a2b2a1a1a1 (G-L13) formerly G2a3b1a1a; G2a2b2a1a1c1a (G-CTS5990 or G-Z1903) formerly G2a3b1a3; G2b (G-M3115) and; G2b1 (G-M377), formerly G2b. Spallanzani, Universit di Pavia, Pavia, Italy, Viola Grugni,Vincenza Battaglia,Carmela Nici,Francesca Crobu,Sena Karachanak,Baharak Hooshiar Kashani&Ornella Semino, Department of Medical Genetics, Medical University of Sofia, Sofia, Bulgaria, National Institute of Genetic Engineering and Biotechnology (NIGEB), Tehran, Iran, Istituto di Genetica Molecolare Centro Nazionale delle Ricerche, Pavia, Italy, Centro Interdipartimentale Studi di Genere, Universit di Pavia, Pavia, Italy, Unit Mixte de Recherche 6578, Centre National de la Recherche Scientifique, and Etablissement Franais du Sang, Biocultural Anthropology, Medical Faculty, Universit de la Mditerrane, Marseille, France, Estonian Academy of Sciences, Tallinn, Estonia, Department of Biological Anthropology, University of Cambridge, Cambridge, UK, Department of Genetics, Stanford University School of Medicine, Stanford, CA, USA, You can also search for this author in The genetic variation in the R1a clade among the Ashkenazi - Nature Thus inferences regarding migratory histories must be viewed cautiously, as diversities may have changed over the time spans discussed. Bosch E, Calafell F, Comas D, Oefner PJ, Underhill PA, Bertranpetit J : High-resolution analysis of human Y-chromosome variation shows a sharp discontinuity and limited gene flow between northwestern Africa and the Iberian Peninsula. G-M201 is most commonly found among various ethnic groups of the Caucasus, but is also widely distributed at low frequencies among ethnic groups throughout Europe, South Asia, Central Asia, and North Africa. Eur J Hum Genet 2009; 17: 820830. In order to determine if one of these alternative SNPs represents a subclade of M201, the alternative SNPs must be tested in G persons who are negative for the known subclades of G. There are only a tiny number of persons in such a category, and only a tiny number of persons have been tested for G equivalent SNPs other than M201. Croat Med J 2005; 46: 502513. Interestingly, the L30 SNP, phylogenetically equivalent to M485, M547 and U8, was detected in an approximately 7000-year-old Neolithic specimen from Germany, although this ancient DNA sample was not resolved further to additional sub-clade levels.39. The Y-chromosomal haplogroup G (hg G) is currently defined as one of the 20 standard haplogroups comprising the global Y-chromosome phylogeny.1 The phylogeographic demarcation zone of hg G is largely restricted to populations of the Caucasus and the Near/Middle East and southern Europe. The phylogeny obtained for haplogroup Q-M378 comprising 5.2% of the Ashkenazi paternal variation 24, shows a similar pattern to that observed for haplogroup G-M377 (Supplemental Figure S5). Keller A, Graefen A, Ball M et al. No labs have yet assigned them shorthand names. Where did the haplogroup G-M201 originate? - Quora G2a2b1 is more common in southern Europe than northern Europe. Nonetheless, coalescent times provide a valuable/informative relative metric for estimating the time of lineage formation. EKK thanks the Russian Academy of Sciences Program for Fundamental Research Biodiversity and dynamics of gene pools, the Ministry of Education and Science of the Russian Federation for state contracts P-325 and 02.740.11.07.01, and the Russian Foundation for Basic Research for grants 04-04-48678- and 07-04-01016-. The complexity is apparent in both the phylogenetic resolution and geographic patterning within hgs G and J2a. RV thanks the European Union Regional Development Fund for support through the Centre of Excellence in Genomics, the Estonian Ministry of Education and Research for the Basic Research grant SF 0270177As08. The Caucasus are today mainly the countries of Georgia, Armenia, Azerbaijan and southwestern Russia. ), Ancient G-M201s with sequencing[self-published source?] Included within G-L91 are some men with double values for STR marker DYS19, but there are also G2a2 men with this finding who are not L91+. Important caveats to consider include the fact that Td is sensitive to authentic rare outlier alleles and that multiple founders during population formation will inflate the age estimate of the event. Basically, haplogroups refer to organisms that have a common ancestor, identified by studying the nucleotide and mitochondrial mutations in cells. It is a branch of Haplogroup F (M89), and is theorized to have originated, according to the latest thinking, in the Near East or Southern Asia, likely in the region that is now northern India, Pakistan, and Afghanistan. Am J Hum Genet 2004; 74: 788788. Its age is between 7,700 and . This value of 12 is uncommon in other G categories other than G1. The coming of the Greeks to Provence and Corsica: Y-chromosome models of archaic Greek colonization of the western Mediterranean. A separate study on the Argyns found that 71% of males belong to G1. [Origin of European 3/6] First Farmer of Europe and Y-DNA Haplogroup G Parallel evolution of genes and languages in the Caucasus region. G-L14 | Haplogroup G2a1a persons also typically have higher values for DYS385b, such as 16, 17 or 18, than seen in most G persons. (2004) Origin, diffusion, and differentiation of Y-chromosome haplogroups E and J: inferences on the neolithization of Europe and later migratory events in the . G1-M285, previously described in the Iranian population . The G-M286 subclade (M286+) is small compared with G-L91. However, interpretations based on simple haplogroup frequency clines do not recognize underlying patterns of genetic diversification. ), Haplogroup M, as of 2017, is also known as K2b1b. The highest frequencies of haplogroup G appear in the Caucasus region; however it also shows significant frequencies in the Mediterranean areas and the Middle East [69,70]. Its chromosome location listed as 21653414. Farther north, 8% of ethnic Hungarian males and 5.1% of ethnic Bohemian (Czech) males have been found to belong to Haplogroup G. In South Asia, some ethnic minorities possess haplogroup G at concentrations of approximately 18%[21] to 20%[22] of Kalash, approximately 16% of Brahui,[22] and approximately 11.5% of sampled Pashtun,[21] but in only about 3% of the general Pakistani population. Men who belong to this group but are negative for all G2 subclades represent a small number of haplogroup G men. Hum Hered 2006; 61: 132143. For the human mtDNA haplogroup, see. In 2012, SNPs with the Z designation as first identified by citizen researchers from 1000 Genomes Project data began to appear. P15 was identified at the University of Arizona and became widely known by 2002. PLoS Biol 2010; 8: e1000536. Dulik MC, Zhadanov SI, Osipova LP et al. A relatively high percentage of G2a2b1 persons have a value of 21 at STR marker DYS390. Origins and history of European Y-DNA and mtDNA haplogroups Haplogroup G2a (Y-DNA) - Facebook In contrast, the only U1 representative in Europe is the G-M527 lineage whose distribution pattern is consistent with regions of Greek colonization. Karafet TM, Mendez FL, Meilerman MB, Underhill PA, Zegura SL, Hammer MF : New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree. (a) Principal component analysis by population. Haplogroup_G_(Y-DNA) The most recent study (2010) estimates the common ancestor of all men in haplogroup G lived in Asia about 17,000 years ago, and the ancestor of the G2 subgroup lived about 15,000 years ago. Reduced genetic structure of the Iberian peninsula revealed by Y-chromosome analysis: implications for population demography. Polarity and temporality of high-resolution y-chromosome distributions in India identify both indigenous and exogenous expansions and reveal minor genetic influence of Central Asian pastoralists. Almost all haplogroup G1 persons have the value of 12 at short tandem repeat (STR) marker DYS392 and all will have the M285 or M342 SNP mutation which characterizes this group. The extreme rarity of G-M377 in northern Pakistan could indicate that G2b in this area originates outside the region and was brought there in the historic period, perhaps from further west (Pakistan was part of both the Achaemenid Persian Empire, conquered by Alexander the Great, and then formed a part of the Greco-Bactrian Kingdom). Achilli A, Olivieri A, Pala M et al. In the case of the general frequency pattern of hg G, panel (a) was obtained by applying the frequencies from Supplementary Table S1 together with data taken from the literature, concerning 569 individuals representing 7 populations comprising Algerians,47 Oromo and Amhara Ethiopians,48 and Berbers, Arabs and Saharawis from Morocco.49 Dots on the map (a) indicate the approximate locations of the sampled populations. This is likely due to a local founder effect.[40]. The reliability of both P16 and P18 in identifying everyone in each of these categories has been questioned and individual components of the SNP have to be examined. You are using a browser version with limited support for CSS. Haplogroup K2e (K-M147) was previously known as "Haplogroup X" and "K2a" (but is a sibling subclade of the present K2a). G-L13/S13 (Y-DNA) - geni family tree Origin. In descending order, G-P303 is additionally a branch of G2 (P287), G2a (P15), G2a2, G2a2b, G2a2b2, and finally G2a2b2a. Specifications for most markers have been previously reported,1, 17, 28 ISOGG 2011 (http://www.isogg.org/tree/). Balanovsky O, Rootsi S, Pshenichnov A et al. Capelli C, Brisighelli F, Scarnicci F et al. Please help update this article to reflect recent events or newly available information. We emphasize that our assessments are based solely on contemporary DNA distributions rather than actual prehistoric patterns. Pichler I, Fuchsberger C, Platzer C et al. Kaniewski D, Van Campo E, Van Lerberghe K et al. In human genetics, Haplogroup G-P303 ( G2a2b2a, [2] formerly G2a3b1) is a Y-chromosome haplogroup. Taken as a collective group, P303-derived chromosomes are the most widespread of all hg G lineages (Supplementary Table S1 and Figure 2b) and clearly display differential geographic partitioning between L497 (Figure 2c) and U1 (xM527) (Figure 2d). Lacan M, Keyser C, Ricaut FX et al. Furthermore, the U1-specific sub-clade M527 is most pronounced among Ukrainians and Anatolian Greeks. This haplogroup was found in a Neolithic skeleton from around 5000 BC, in the cemetery of Derenburg Meerenstieg II, Germany, which forms part of the Linear Pottery culture, known in German as Linearbandkeramik (LBK),[11] but was not tested for G2a3 subclades. https://doi.org/10.1038/ejhg.2012.86, DOI: https://doi.org/10.1038/ejhg.2012.86. Haplogroup Definition & Meaning | Dictionary.com We estimate that the geographic origin of hg G plausibly locates somewhere nearby eastern Anatolia, Armenia or western Iran. Flores C, Maca-Meyer N, Gonzalez AM et al. These five major sub-clades of the G2 branch show distinct distribution patterns over the whole area of their spread. Looking still more closely at the distribution of P303 sub-clades, some distinct patterns emerge in the network (Figure 4). The forward primer is GTATTGAACTTACAATTCACGTCCC, and the reverse is CTCTCCAAATCGGGTTTCCT. Population codes: Baltics (Blt), Belarusians (Blr), Poles (Pol), Ukrainians (Ukr), northern Russians (NRu), southern and central Russians (SRu), Circum-Uralic (CUr), Germans (Ger), Central Europeans (CE), Iberians (Ibr), French (Fra), Sardinians (Srd), Corsica (Cor), Sicilians (Sic), Italians (Ita), Switzerlands (Swi), Western Balkans (WB), Romanians (Rmn), Bulgarians (Bul), Crete (Crt), Greeks (Grc), Anatolian Greeks (AG), Egyptians (Egy), Near/Middle Easterners (ME), Ashkenazi Jews (AJ), Sephardic Jews (SJ), Arabian Peninsula (AP), Palestinians (Pal), Druze (Drz), Western Turks (WTu), Central Turks (CTu), Eastern Turks (ETu), Iranians (Irn), Abkhazians (Abh), Armenians (Arm), Georgians (Grg), South Ossetians (SOs), Iranian Azeris (Azr), Abazins (Aba), Adyghes (Ady), Balkars (Blk), Cherkessians (Crk), Kabardins (Kab), Karachays (Kar), Kuban Nogays (Nog), North Ossetians (NOs), Chamalals (Cha), Ingushes (Ing), Kumyks (Kum), Central Asians (CA), Pakistani (Pak). It is notable that tzi the 5300-year-old Alpine mummy was derived for the L91 SNP and his autosomal affinity was nearest to modern Sardinians.28, The G2a2-M286 lineage is very rare, so far detected only in some individuals in Anatolia and the South Caucasus. Semino et al. (This followed the publication of: Haplogroup K2b (M1221/P331/PF5911) is also known as Haplogroup MPS. G-M406* (G2a2b1*; previously G2a3a*) and its subclades seem most commonly found in Turkey and the coastal areas of the eastern Mediterranean where it can constitute up to 5% of all makes and 50% of haplogroup G samples. Hum Genet 2009; 126: 707717. Haplogroup G (M201) is a human Y-chromosome haplogroup. Such temporal estimates must be viewed with caution owing to differences in individual STR locus mutation rates, sensitivity to rare outlier STR alleles and complexities related to multiple potential founders during a demographic event. The L141 mutation involves an insertion.[35]. AAL thanks the Sorenson Molecular Genealogy Foundation. Zhivotovsky LA, Underhill PA, Cinnioglu C et al. The L91 mutation is found at 21327383 and rs35474563 on the Y-chromosome. Artefactual values below 0% values were not depicted. Haplogroup G, together with J2 clades, has been associated with the spread of agriculture, especially in the European context. In the northern and highland areas of the island of Sardinia off western Italy, G percentages reach 11% of the population in one study[17] and reached 21% in the town of Tempio in another study. It remains to be seen if testing will reveal G-M377 haplotypes in other populations this is some indication that G-M377 occurs at low levels in the Near East. Also for P15* and L91 lineages Td estimates, DYS19 was excluded owing to duplications in these lineages.36. The emergence of Y-chromosome haplogroup J1e among Arabic-speaking populations. G-L91 would seem to encompass a significant proportion of men belonging to G. L91 is found so far in scattered parts of Europe and North Africa and in Armenia. SD was also calculated for the age estimates according to the following formula: 25/1000 (ASD0 variance)/0.00069. Am J Hum Genet 2006; 78: 202221. The L141 mutation is found on the Y chromosome at 2948607. The non-clustering paraphyletic, hg G sub-group P303* residuals consist of samples from Near/Middle Eastern, Caucasian and European populations. Nei M : Molecular Evolutionary Genetics. Haplogroup S, as of 2017, is also known as K2b1a. Provided by the Springer Nature SharedIt content-sharing initiative, European Journal of Human Genetics (2021), European Journal of Human Genetics (2020), European Journal of Human Genetics (Eur J Hum Genet) Semino O, Santachiara-Benerecetti AS, Falaschi F, Cavalli-Sforza LL, Underhill PA : Ethiopians and Khoisan share the deepest clades of the human Y-chromosome phylogeny. In addition, we introduce five new markers: M426, M461, M485, M527 and M547 (Supplementary Table S2). G-L42/S146 (Y-DNA) - geni family tree In the Americas, the percentage of haplogroup G corresponds to the numbers of persons from Old World countries who emigrated. In addition, K-Y28299, which appears to be a primary branch of K-M2313, has been found in three living individuals from India. The network was obtained using the biallelic markers P303, M426, L497, U1, M527 and 19 STR loci (DYS19, DYS388, DYS389I, DYS389b, DYS390, DYS391, DYS392, DYS393, DYS439, DYS461 (TAGA counts), DYS385a,b, DYS437, DYS438, DYS448, DYS456, DYS458, DYS635, YGATAH4). Haplogroup G-M201 | Familypedia | Fandom [6], A more eastern origin has also been mentioned, believed by some to originate in an area close to the Himalayan foothills. Ancient DNA from European early neolithic farmers reveals their near eastern affinities. Encyclopedia of mtDNA Origins - Discover your maternal lineage. A more compact cluster of Near/Middle Eastern samples is also resolved in the network. Considering these issues, we acknowledge that the variance of the age estimates may be underestimated. Supplementary Information accompanies the paper on European Journal of Human Genetics website, Rootsi, S., Myres, N., Lin, A. et al. 25 and 0.00069 denote the assumed average generation time in years and the effective mutation rate, respectively, and 1000 is used to convert the result of the equation (into thousands of years). The mutation involves a change from C to T.[citation needed] L223 is found on the Y chromosome at rs13304806. Although not exceeding 3% frequency overall, haplogroup G1-M285 reflects a branching event that is phylogenetically equivalent to the more widespread companion G2-P287 branch in the sense that both branches coalesce directly to the root of G-M201. ), International Society of Genetic Genealogy, List of genetic results derived from historical figures, Y-chromosome haplogroups in populations of the world, Y-DNA haplogroups in populations of Europe, Y-DNA haplogroups in populations of the Caucasus, Y-DNA haplogroups in populations of the Near East, Y-DNA haplogroups in populations of North Africa, "Distinguishing the co-ancestries of haplogroup G Y-chromosomes in the populations of Europe and the Caucasus", Atlas of the Human Journey: Haplogroup G (M201), "The Geographic Origins of Ethnic Groups in the Indian Subcontinent: Exploring Ancient Footprints with Y-DNA Haplogroups", "Late Pleistocene human genome suggests a local origin for the first farmers of central Anatolia", "Early farmers from across Europe directly descended from Neolithic Aegeans", "Ancient DNA suggests the leading role played by men in the Neolithic dissemination", "Ancient DNA from European Early Neolithic Farmers Reveals Their Near Eastern Affinities", "From surnames to the history of Y chromosomes: the Sardinian population as a paradigm", "Paleolithic Y-haplogroup heritage predominates in a Cretan highland plateau", "Y-chromosomal evidence of the cultural diffusion of agriculture in southeast Europe", "Y Chromosomal Evidence for a Limited Greek Contribution to the Pathan Population of Pakistan", "Polarity and temporality of high-resolution y-chromosome distributions in India identify both indigenous and exogenous expansions and reveal minor genetic influence of Central Asian pastoralists", "A prehistory of Indian Y chromosomes: Evaluating demic diffusion scenarios", "Dual Origins of the Japanese: Common Ground for Hunter-Gatherer and Farmer Y-Chromosomes", "Dissecting the influence of Neolithic demic diffusion on Indian Y-chromosome pool through J2-M172 haplogroup", "Isolates in a corridor of migrations: a high-resolution analysis of Y-chromosome variation in Jordan", "Chromosome Diversity Characterizes the Gulf of Oman", "The Druze: A Population Genetic Refugium of the Near East", "The Levant versus the Horn of Africa: Evidence for Bidirectional Corridors of Human Migrations", "Geographical Structure of the Y-Chromosomal Genetic Landscape of the Levant: A Coastal-Inland Contrast", "The place of the Basques in the European Y-chromosome diversity landscape", "A Back Migration from Asia to Sub-Saharan Africa Is Supported by High-Resolution Analysis of Human Y-Chromosome Haplotypes", "Kinship and Y-Chromosome Analysis of 7th Century Human Remains: Novel DNA Extraction and Typing Procedure for Ancient Material", "The genetic legacy of religious diversity and intolerance: paternal lineages of Christians, Jews, and Muslims in the Iberian Peninsula", http://ytree.ftdna.com/index.php?name=Draft&parent=20173662, "..Project Rosters - Haplogroup G Project", "Extended Y chromosome haplotypes resolve multiple and unique lineages of the Jewish priesthood", "Afghanistan's Ethnic Groups Share a Y-Chromosomal Heritage Structured by Historical Events", "The phylogeography of Y chromosome binary haplotypes and the origins of modern human populations", "New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree", http://ymap.ftdna.com/cgi-bin/gbrowse_details/hs_chrY?name=L240;class=Sequence;ref=ChrY;start=3191153;end=3191153;feature_id=40369, "Improved Resolution Haplogroup G Phylogeny in the Y Chromosome, Revealed by a Set of Newly Characterized SNPs", "Identification of the remains of King Richard III", https://haplogroup.info/all-ancient-dna-full.xlsx, "Results from the Hamman Family Y-Chromosome DNA Tests", "Haplogroup G2a (Y-chromosomal DNA) - Eupedia", Y-DNA Haplogroup G and its subclades from the current year ISOGG haplotree. contracts here. G1 is possibly believed to have originated in Iran. "[3], Previously the National Geographic Society placed its origins in the Middle East 30,000 years ago and presumes that people carrying the haplogroup took part in the spread of the Neolithic. Mol Biol Evol 2011; 29: 359365. The L293 SNP that characterizes a third subclade was identified in June 2010 at Family Tree DNA. Nature 2010; 466: 238242. A network of 61 G2c-M377 lineages from Europe, the Near/Middle East and Central and South Asia reveals founder lineages (one pronounced founder in Ashkenazi Jews and a far distant one among South Asian individuals) and diverged lineages (Supplementary Figure S1). The Etruscans: a population-genetic study. (b) Principal component analysis by hg G sub-clades: (A) M285, P20, P287, P15, L92 P16, M286, M485, P303, U1, L497, M527, M406, Page19, M287 and M377 sub-haplogroups with respect to total M201.
Cody White Obituary Atlanta,
Asymmetrical Long Bob Haircut,
Articles H